puromycin resistance gene  (Addgene inc)

Journal: Frontiers in Immunology

Article Title: Single–gene knockout of RNLS or HIVEP2 are insufficient to protect β–cell spheroids from allo– and xeno–rejection

doi: 10.3389/fimmu.2026.1759835

Figure Lengend Snippet: Genomic validation of CRISPR/Cas9 editing in mouse and human β–cell lines. (a) T7E1 assay of genomic PCR products amplified from stable, antibiotic-selected populations of β–TC–6 cells with three gRNAs targeting Hivep2 , Ins2 or Rnls (left), alongside the corresponding non–targeting (NT) controls (right). Cleavage products visible for Hivep2 –g2, all three Ins2 guides and Rnls –g3 confirm formation of indels, whereas NT lanes show only full–length amplicons. (b) TIDE quantification in mouse cells. Left: indel percentage. Right: representative TIDE decomposition. (c) T7E1 assay of genomic PCR products amplified from stable, antibiotic-selected populations of EndoC–βH1 cells edited with guides against HIVEP2 , INS or RNLS . Cleavage is evident for all three HIVEP2 and INS guides, and for RNLS –g2, whereas NT controls are uncleaved. (d) TIDE quantification in human cells. Left: indel percentage. Right: representative TIDE decomposition.

Article Snippet: After an initial screen of T7EI and TIDE analysis, one gRNA was selected for each gene as follows: NT gRNA (5′–GCGCTTCCGCGGCCCG–3′), Hivep2 gRNA (5′–TAAGGCGGATGACTCTCACA–3′), Ins2 gRNA (5′–GGACTCCCAGAGGAAGAGCA–3′), and Rnls gRNA (5′– CTACTCCTCTCGCTATGCTC–3′) were cloned into pLentiCRISPRv2 vector with puromycin antibiotic resistance gene (Addgene #98290) ( ).

Techniques: Biomarker Discovery, CRISPR, Amplification